N/A
|
Standard format: Plasmid sent in bacteria as agar stab
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-let-7i-5p Accession Number: MIMAT0000122 Mature Sequence: UGAGGUAGUAGUUUGUGCUGUU mmu-let-7i-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
MicroRNA: hsa-let-7i-5p Accession Number: MIMAT0000415 Mature Sequence: UGAGGUAGUAGUUUGUGCUGUU hsa-let-7i-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
MicroRNA: rno-let-7i-5p Accession Number: MIMAT0000779 Mature Sequence UGAGGUAGUAGUUUGUGCUGUU rno-let-7i-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |